View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16038_low_4 (Length: 344)
Name: NF16038_low_4
Description: NF16038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16038_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 195 - 327
Target Start/End: Complemental strand, 16438156 - 16438028
Alignment:
| Q |
195 |
agctagttatatttgcgctacccttccacctatcgacttctagaggaattgatttgtcttctagattcttgtgggtcaaacacttttgttctagattggg |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| || ||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16438156 |
agctagttatatttgcgctaccattccacctatcgacatccagagg----gatttgtcttctggattcttgtgggtcaaacacttttgttttagattggg |
16438061 |
T |
 |
| Q |
295 |
agttagtatctagtgtcaagattttgggctgat |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16438060 |
agttagtatctagtgtcaagattttgggctgat |
16438028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 16438349 - 16438223
Alignment:
| Q |
1 |
tgaattttggttgaagtgatgatgacgagtttgcgggttgattccatttttgggggtttgttttgtttctctttctttatctgctctttgtcaccttcga |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||| ||||||||||| ||||||||||||||| ||||||||| ||| | |||||| |||||||| |
|
|
| T |
16438349 |
tgaattttggttgaagtgatgatgaggagtttgtgggttggttccatttttgagggtttgttttgtttttctttctttgtctac-ctttgttaccttcga |
16438251 |
T |
 |
| Q |
101 |
tttggatcaatctccactgtcgctgcca |
128 |
Q |
| |
|
|||||||| ||||||| |||||||||| |
|
|
| T |
16438250 |
tttggatccatctccaaagtcgctgcca |
16438223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University