View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16038_low_4 (Length: 344)

Name: NF16038_low_4
Description: NF16038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16038_low_4
NF16038_low_4
[»] chr6 (2 HSPs)
chr6 (195-327)||(16438028-16438156)
chr6 (1-128)||(16438223-16438349)


Alignment Details
Target: chr6 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 195 - 327
Target Start/End: Complemental strand, 16438156 - 16438028
Alignment:
195 agctagttatatttgcgctacccttccacctatcgacttctagaggaattgatttgtcttctagattcttgtgggtcaaacacttttgttctagattggg 294  Q
    |||||||||||||||||||||| |||||||||||||| || |||||    |||||||||||| ||||||||||||||||||||||||||| |||||||||    
16438156 agctagttatatttgcgctaccattccacctatcgacatccagagg----gatttgtcttctggattcttgtgggtcaaacacttttgttttagattggg 16438061  T
295 agttagtatctagtgtcaagattttgggctgat 327  Q
    |||||||||||||||||||||||||||||||||    
16438060 agttagtatctagtgtcaagattttgggctgat 16438028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 16438349 - 16438223
Alignment:
1 tgaattttggttgaagtgatgatgacgagtttgcgggttgattccatttttgggggtttgttttgtttctctttctttatctgctctttgtcaccttcga 100  Q
    ||||||||||||||||||||||||| ||||||| |||||| ||||||||||| ||||||||||||||| ||||||||| ||| | |||||| ||||||||    
16438349 tgaattttggttgaagtgatgatgaggagtttgtgggttggttccatttttgagggtttgttttgtttttctttctttgtctac-ctttgttaccttcga 16438251  T
101 tttggatcaatctccactgtcgctgcca 128  Q
    |||||||| |||||||  ||||||||||    
16438250 tttggatccatctccaaagtcgctgcca 16438223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University