View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16038_low_5 (Length: 333)
Name: NF16038_low_5
Description: NF16038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16038_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 204 - 320
Target Start/End: Complemental strand, 33329233 - 33329117
Alignment:
| Q |
204 |
caatatactgaacaacacactttcataaagatcttataataaaacataaaatatgattatagttgtaccttaaaccattatccaaaagctcaaattattt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33329233 |
caatatactgaacaacacactttcataaagatcttataataaaacataaaatatgattatagttgtaccttaaaccattatccaaaagctcaaattattt |
33329134 |
T |
|
| Q |
304 |
aaaaaaggatgaaaatg |
320 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33329133 |
aaaaaaggatgaaaatg |
33329117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 257 - 316
Target Start/End: Complemental strand, 42856255 - 42856196
Alignment:
| Q |
257 |
tgattatagttgtaccttaaaccattatccaaaagctcaaattatttaaaaaaggatgaa |
316 |
Q |
| |
|
|||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42856255 |
tgattataattgtatcctaaaccattatccaaaagctcaaattatttaaaaaaggatgaa |
42856196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University