View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16038_low_7 (Length: 285)
Name: NF16038_low_7
Description: NF16038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16038_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 45 - 264
Target Start/End: Original strand, 43663988 - 43664207
Alignment:
| Q |
45 |
cttggtctccagttagcaatcaagggtgaaattaatttttgatattattcacacggcactagagctgcaataccaccaatcatatatttgttgtgctatt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43663988 |
cttggtctccagttagcaatcaagggtgaaattaatttttgatattattcacacggcactagagctgcaataccaccaatcatatatttcttgtgctatt |
43664087 |
T |
|
| Q |
145 |
ttataatgtttgagttgcatggcattaaaatttgtgatatttatcccacaacaatatttgattatttgtggtcatgtatgaccttgattccaagaaagga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43664088 |
ttataatgtttgagttgcatggcattaaaatttgtgatatttatcccacaacaatatttgattatttgtggtcatgtatgaccttgattccaagaaagga |
43664187 |
T |
|
| Q |
245 |
attgccgtcaaattatttag |
264 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43664188 |
attgccgtcaaattatttag |
43664207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University