View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16038_low_8 (Length: 284)
Name: NF16038_low_8
Description: NF16038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16038_low_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 284
Target Start/End: Complemental strand, 42933793 - 42933520
Alignment:
| Q |
14 |
gacatcatcgacaacatattgttgctgcagttgcaattgctgttgaggcagcatattcatattcatattcagttgatcatcaacaaaatgctgctggtta |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42933793 |
gacatcatcgacaacatattgctgctgcagttgcaattgctgttgaggcagcatattcatattca------gttgatcatcaacaaaatgctgctggtta |
42933700 |
T |
|
| Q |
114 |
aaatgattgataatattcaaagcagcatcattatcctcgttattgttatgattaatgacatgcatgtcattataatgatgattagccacagaggcaaatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
42933699 |
aaatgattgataatattcaaagcagcatcattatcctcgttattgttatgattaatgacatgcatgtcattataatgatgattagacacagcggcaaatt |
42933600 |
T |
|
| Q |
214 |
gtt---------gttgtgattgtgtagctttacaaatagaaatttgttgacgtgtaaaatgaagctcagcttgataaaat |
284 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42933599 |
gttgttgatgttgttgtgattgtgtagctttacaaatagaaatttgttgacgtgtaagatgaagctcagcttgataaaat |
42933520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University