View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1603_low_10 (Length: 241)
Name: NF1603_low_10
Description: NF1603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1603_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 122 - 189
Target Start/End: Original strand, 52794481 - 52794549
Alignment:
| Q |
122 |
tccccaaacaactaatcaatgtcgagatctagttttc-tttttcttttgatcgtatcaatgttgattct |
189 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52794481 |
tccccaaacaactaatcaatgacgagatctagttttcttttttcttttgatcgtatcaatgttgattct |
52794549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 184 - 228
Target Start/End: Original strand, 52796839 - 52796883
Alignment:
| Q |
184 |
gattctcagcatttcattgtcatcaactactgttgcagcagtgaa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796839 |
gattctcagcatttcattgtcatcaactactgttgcagcagtgaa |
52796883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 87 - 124
Target Start/End: Original strand, 52794421 - 52794458
Alignment:
| Q |
87 |
cacttactcactcttatcacacatttcaatttcaatcc |
124 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52794421 |
cactcactcactcttatcacacatttcaatttcaatcc |
52794458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 52798641 - 52798689
Alignment:
| Q |
160 |
ttttcttttgatcgtatcaatgttgattctcagcatttcattgtcatca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||| ||||| |||| |
|
|
| T |
52798641 |
ttttcttttgatcgtatcaatgttgattatcaacattttattgttatca |
52798689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 201
Target Start/End: Original strand, 39710357 - 39710398
Alignment:
| Q |
160 |
ttttcttttgatcgtatcaatgttgattctcagcatttcatt |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
39710357 |
ttttcttttgattgtatcaatgttgattcttagcacttcatt |
39710398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University