View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16040_high_14 (Length: 373)
Name: NF16040_high_14
Description: NF16040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16040_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 16 - 359
Target Start/End: Original strand, 36018540 - 36018875
Alignment:
| Q |
16 |
atatatgtattacatagacgggtcaccgttgtggtagacgcccacacaatgtttgtactttggttaactataattttattttgtttaggaaaggatttgg |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36018540 |
atatatgt-ttacatagacgggtcaccgttgtggtagacgcccacacaatgtttgtactttggttaactataattttattttgtttagtaaaggatttgg |
36018638 |
T |
|
| Q |
116 |
ttaactataattatcgtctcaactctcaataaccaattaaccagcatgatttttaaaatatcgggtatcattattgatcttgaaacacttttctcgtttt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36018639 |
ttaactataattatcgtctc-------aataaccaattaaccagcatgatttttaaaatattgggtatcattattgatcttgaagcacttttctcgtttt |
36018731 |
T |
|
| Q |
216 |
tgttttgttcatatgcaacgtgttaaatgcctttccgatatcaccttagaggaaaagagggagataatcaatttggatttaccgaatgattcttttcaat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36018732 |
tgttttgttcatatgcaacgtgttaaatgcctttccgatatcgccttagaggaaaagagggagataatcaatttggatttaccgaatgattcttttcaat |
36018831 |
T |
|
| Q |
316 |
caatttggatttactgaatgactcttttcatgaataaagtatat |
359 |
Q |
| |
|
||||||||||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
36018832 |
caatttggattgagtgaatgattcttttcatgaataaagtatat |
36018875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University