View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16040_high_15 (Length: 341)
Name: NF16040_high_15
Description: NF16040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16040_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 14 - 323
Target Start/End: Original strand, 43672811 - 43673120
Alignment:
| Q |
14 |
gcaaaggcaagattccattttatttgatagtttcttataacttacggatccatttttatggttgacttggtttcataatatatggtccttcattccttcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672811 |
gcaaaggcaagattccattttatttgatagtttcttataacttacggatccatttttatggttgacttggtttcataatatatggtccttcattccttcc |
43672910 |
T |
 |
| Q |
114 |
tcactctttatttttatcactatttagtccatatgagtttggtagggaagaaacttaaaagagtatgacagatgttgtgtcgatatttggtggtttagac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672911 |
tcactctttatttttatcactatttagtccatatgagtttggtagggaagaaacttaaaagagtatgacagatgttgtgtcgatatttggtggtttagac |
43673010 |
T |
 |
| Q |
214 |
tttagtatagtatttgatgagaaacaatgttattattaacttcatcagttttgatttcattagggttctttattaagatcttcaactctgctgtttgata |
313 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43673011 |
tttagtatagtatttgatgagaaacagtgttattattaacttcatcagttttgatttcattagggttctttattaagatcttcaactctgctgtttgata |
43673110 |
T |
 |
| Q |
314 |
tgattagagg |
323 |
Q |
| |
|
|||||||||| |
|
|
| T |
43673111 |
tgattagagg |
43673120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University