View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16040_high_22 (Length: 241)
Name: NF16040_high_22
Description: NF16040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16040_high_22 |
 | |
|
| [»] scaffold0176 (3 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 141
Target Start/End: Original strand, 33831800 - 33831929
Alignment:
| Q |
12 |
atgaaatctttcttttctttagtggtctaatgcacgtgccttcaatgtgtactatttagcactctgtaaatagattttattatacttgcataatgcatat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33831800 |
atgaaatctttcttttctttagtggtctaatgcacgtgccttcaatgtgtactatttagcactctgtaaatagattttattatacttgcataatgcatat |
33831899 |
T |
|
| Q |
112 |
tgcttatagaaaaactcaaaataaacgagc |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33831900 |
tgcttatagaaaaactcaaaataaacgagc |
33831929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 140 - 224
Target Start/End: Original strand, 33831956 - 33832041
Alignment:
| Q |
140 |
gcctctggttctacaacaaaa-aacaattttgaaatcgagattaagaacctttcttgcaacttgcatccatatcaaccagagttgt |
224 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33831956 |
gcctctggttctacaacaaaaaaacaattttgaaatcgagattaagaacctttcttgcaacttgcatccatatcaaccagagttgt |
33832041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 53 - 141
Target Start/End: Original strand, 14517 - 14614
Alignment:
| Q |
53 |
tcaatgtgtactatttagcactctgtaaatagatttta--------ttatacttg-cataatgcatattgcttatagaaaaactcaaaataaacgagc |
141 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14517 |
tcaatgtgtactgtttagcactctgtaaatagattttgaatatcccttatacttggcataatgcattttgcttatagaaaaactcaaaataaacgagc |
14614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 12 - 66
Target Start/End: Original strand, 14446 - 14500
Alignment:
| Q |
12 |
atgaaatctttcttttctttagtggtctaatgcacgtgccttcaatgtgtactat |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
14446 |
atgaaatctttcttttctttagtggtctaattcacgtgccttcaatatgtactat |
14500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 142 - 208
Target Start/End: Original strand, 14643 - 14709
Alignment:
| Q |
142 |
ctctggttctacaacaaaaaacaattttgaaatcgagattaagaacctttcttgcaacttgcatcca |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
14643 |
ctctggttctacagcaaaaaacaattttgaaattcagatcaagaaccttctttgcaacttgcatcca |
14709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University