View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16040_low_26 (Length: 210)
Name: NF16040_low_26
Description: NF16040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16040_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 45980509 - 45980326
Alignment:
| Q |
12 |
agataattctgctttttatttattaattttaatttcattgttagctgagtttattaggttgtgataaagctctggattgtaaatctttgatgagatttct |
111 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45980509 |
agatacttctgctttttatttattaactttaatttcattgttagctgagtttattaggttgtgataaagctctggattgtaaatctttgatgagatttct |
45980410 |
T |
 |
| Q |
112 |
gcccaaaaggtgaatatgtaaagggaaagt-nnnnnnnnnnncattatcacatgttaaggaatagttgtttacagctttacttg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45980409 |
gcccaaaaggtgaatatgtaaagggaaagtaaaaaaaaaaaacattatcacatgttaaggaatagttgtttacagctttacttg |
45980326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 190
Target Start/End: Complemental strand, 45974302 - 45974209
Alignment:
| Q |
97 |
tttgatgagatttctgcccaaaaggtgaatatgtaaagggaaagtnnnnnnnnnnncattatcacatgttaaggaatagttgtttacagcttta |
190 |
Q |
| |
|
||||| ||||||||| | | ||||||||||||||||||||||||| || || ||||||||||||||| |||||||||||||||| |
|
|
| T |
45974302 |
tttgaagagatttcttcaccaaaggtgaatatgtaaagggaaagtcataaagaaaacaataacacatgttaaggaattgttgtttacagcttta |
45974209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University