View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16040_low_27 (Length: 209)
Name: NF16040_low_27
Description: NF16040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16040_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 33507709 - 33507515
Alignment:
| Q |
1 |
ccctaattctattctatttctgtgtttattttgcagagaaataatggaagctactcaaatacttctttgtttaattctaaccctattatgttactgtttt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33507709 |
ccctaattctattctatttctgtgtatattttgcagagaaataatggaagctactcaaatacttctgtgtttaattctaaccctattatgttactgtttt |
33507610 |
T |
 |
| Q |
101 |
atatatcttttatgccgctctattctttcattcttcttcaaactttttctagtcatatgttttcctgtcactcaagcattgttgtttctgttcat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33507609 |
atatatcttttatgccgctctattctttcattcttcttcaaactttttctagtcatatgttttcctgtcactcaagcattgtcgtttctgttcat |
33507515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University