View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16041_high_20 (Length: 208)
Name: NF16041_high_20
Description: NF16041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16041_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 5548463 - 5548656
Alignment:
| Q |
1 |
tgtttgtggcctttcatttctgtgttttaatttgatggtgattgtgaacattactgtttgttatgagattgatgtgaagttttgatctttcatgttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5548463 |
tgtttgtggcctttcatttctgtgttttaatttgatggtgattgtgaacattactgtttgttatgagattgatgtgaagttttgatctttcatgttgttg |
5548562 |
T |
 |
| Q |
101 |
aaaatgtggtggaaaaaggttttctgaaaaagggtcaattgtgattgtgatgtggatgattatgtgattgttagggttgccccacatgtttttt |
194 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5548563 |
aaaatgtggtggaaaagggttttctgaaaaagggtcaattgtgattgtgatgtggatgattatgtgattgttagggttgccccacatgtttttt |
5548656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 116
Target Start/End: Complemental strand, 5543760 - 5543682
Alignment:
| Q |
38 |
gtgattgtgaacattactgtttgttatgagattgatgtgaagttttgatctttcatgttgttgaaaatgtggtggaaaa |
116 |
Q |
| |
|
|||| |||| || ||| |||||||||||||||||| | |||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
5543760 |
gtgaatgtgcaccttagtgtttgttatgagattgaggaaaagttttgttctttcatgctgttcaaaatgtggtggaaaa |
5543682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University