View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16041_low_10 (Length: 372)
Name: NF16041_low_10
Description: NF16041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16041_low_10 |
 | |
|
| [»] scaffold0147 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 78 - 360
Target Start/End: Original strand, 15020 - 15309
Alignment:
| Q |
78 |
tcgtttacaaagttttggcctaacacactcttcttcccaagttattagttttaaaaagttatctttaaacagagaaagnnnnnnnn-------ggcttct |
170 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||| ||||||| |
|
|
| T |
15020 |
tcgtttacaaagtgttggcctaacacactcttcttcccaagttattagttttaaaaagtcatctttaaacaaaaaaaaaaaaaaaaaaaaaaaggcttct |
15119 |
T |
|
| Q |
171 |
tagggtatctcagtgtgtaatgaccaagactaattttcacacacaaatcggctcgaagccataaccacacatttagtgcatgtttggtattcggtatcat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15120 |
tagggtatctcagtgtgtaatgaccaagactaattttcacacacaaatcagctcgaagccataaccacacatttagtgcatgtttggtattcggtatcat |
15219 |
T |
|
| Q |
271 |
ggttaacatatcagagtcacagtgactcactgcaattctgacatacccattgtgatatcaaacatgcacttaaaatctaaattgcttctc |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15220 |
ggttaacatatcagagtcacagtgactcactgcaattctgacatacccactgtgatatcaaacatgcacttaaaatctaaattgcttctc |
15309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 14958 - 15000
Alignment:
| Q |
18 |
atagttgtattgtttatttaatcagacttcgtgctggtaacgg |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14958 |
atagttgtattgtttatttaatcagacttcgtgctagtaacgg |
15000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University