View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16041_low_12 (Length: 317)
Name: NF16041_low_12
Description: NF16041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16041_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 7 - 300
Target Start/End: Original strand, 26768593 - 26768886
Alignment:
| Q |
7 |
gatggtgataagacttatgagtttaccattattattttcacatttcaatttaatatgccaatttatggtaaaatacattaactcactaacattttggaac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26768593 |
gatggtgataagacttatgagtttaccattattattttcacatttcaatttaatatgccaatttatggtaaaatacattaactcactaaaattttggaac |
26768692 |
T |
 |
| Q |
107 |
acaatatgggaccattttttatttccaataaaactcaaatcttgttttatgagtccctacttctatattgatgtcacaaaactgtctagttatttagtga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26768693 |
acaatatgggaccattttttatttccaataaaactcaaatcttgttttatgagtccctacttctatattgatgtcacaaaactgtctagttatttagtga |
26768792 |
T |
 |
| Q |
207 |
ttgactcacatgcttttgtaggaaactttatnnnnnnnttcaatcaatttactttnnnnnnnnttactttcaacggtgatgaagaaaattggct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26768793 |
ttgactcacatgcttttgtaggaaactttataaaaaatttcaatcaatttactttaaaaaaaattactttcaacggtgatgaagaaaattggct |
26768886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University