View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16041_low_15 (Length: 291)
Name: NF16041_low_15
Description: NF16041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16041_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 23 - 275
Target Start/End: Complemental strand, 14811583 - 14811332
Alignment:
| Q |
23 |
accactttcaatgttgttgatagtgttaatggctcctttgccactggtaacaaaaagaggattatgcttaggttgggtacaagggttgtaatggatgata |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811583 |
accactttcaatgttgttgatagtgttaatggctcctttgccactggtaacagaaagagcattatgcttaggttgggtacaagggttgtaatggatgata |
14811484 |
T |
 |
| Q |
123 |
gctttctcattcataagtatgggttgactttgcttcgctctgatgagatcaaaaggccacgttttgatcccgctcgattggttggtatctgtttcgtttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14811483 |
gctttctcattcataagtatgggttgacttcgcttcgctctgatgagatcaaaaggccacgttttgatcccgctcggttggttggtatctgtttcgtttt |
14811384 |
T |
 |
| Q |
223 |
tgtagtctggtttgctttgtcttactgttcatttacattttatgtagtctctg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
14811383 |
tgtagtctggtttgctttgtcttactgtttatttaca-tttatttagtctctg |
14811332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University