View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16041_low_17 (Length: 278)
Name: NF16041_low_17
Description: NF16041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16041_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 2 - 262
Target Start/End: Complemental strand, 3909828 - 3909568
Alignment:
| Q |
2 |
aatacttggtcaatctgaggaagtgaatcaatctataaccagaggtaccaaaacagtcactaaaattgtagatgacacaggaaaagaaaccatgcaaatc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3909828 |
aatacttggtcaatctgaggaagtgaatcaatctataaccagaggtaccaaaacagtcactaaaattgtagatgacacaggaaaacaaaccatgcaaatc |
3909729 |
T |
 |
| Q |
102 |
attgaagatgtggttatttttggacgtcaaaacggcgaagttgtaacaaaaaagaaacatttttggagtgattggggtgtaataggtggtactagttctg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909728 |
attgaagatgtggttatttttggacgtcaaaacggcgaagttgtaacaaaaaagaaacatttttggagtgattggggtgtaataggtggtactagttctg |
3909629 |
T |
 |
| Q |
202 |
aggttgcaaaaacaaagaaacctgaaacaggatctacagacaatagtgattggaaagttat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909628 |
aggttgcaaaaacaaagaaacctgaaacaggatctacagacaatagtgattggaaagttat |
3909568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University