View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16041_low_18 (Length: 268)
Name: NF16041_low_18
Description: NF16041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16041_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 140 - 256
Target Start/End: Complemental strand, 4492664 - 4492546
Alignment:
| Q |
140 |
aatttaaaatagagtaccttgtcatgaagnnnnnnnntgaaggtaagacttttaatagttttgtcatacnnnnnnn--gttgaataaatatagttttgtc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4492664 |
aatttaaaatagagtaccttgtcatgaagaaaaaaaatgaaggtaagacttttaatagttttgtcatactttttttttgttgaataaatatagttttgtc |
4492565 |
T |
|
| Q |
238 |
ctgtttgatattttcttgg |
256 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
4492564 |
ctgtttgatatttttttgg |
4492546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University