View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16042_high_10 (Length: 305)

Name: NF16042_high_10
Description: NF16042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16042_high_10
NF16042_high_10
[»] chr4 (2 HSPs)
chr4 (134-289)||(1203463-1203618)
chr4 (20-48)||(1203704-1203732)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 134 - 289
Target Start/End: Complemental strand, 1203618 - 1203463
Alignment:
134 cagtgtgattcaggtgatgattcgggtccgatttcatacaaccctttggatgaaccaagtccacttggtttgcgtttgaagaagagtccatcacttttgg 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1203618 cagtgtgattcaggtgatgattcgggtccgatttcatacaaccctttggatgaaccaagtccacttggtttgcgtttgaagaagagtccatcacttttgg 1203519  T
234 atttgattcagatgaagctttcacaaacttatgaatctaagaagaaagatcagaag 289  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
1203518 atttgattcagatgaagctttcacaaacttatgaatccaagaagaaagatcagaag 1203463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 48
Target Start/End: Complemental strand, 1203732 - 1203704
Alignment:
20 tcaatctttttgttaatttcatattgggt 48  Q
    |||||||||||||||||||||||||||||    
1203732 tcaatctttttgttaatttcatattgggt 1203704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University