View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16042_high_12 (Length: 282)
Name: NF16042_high_12
Description: NF16042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16042_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 599511 - 599772
Alignment:
| Q |
1 |
ctagtctctttacatattaccttcaataaaacctagtttcatgccaaaatatttatgttttcccttgtttttctagttgaaattttgcctaagaaattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
599511 |
ctagtctctttacatattaccttcaataaaacctagtttcatgccaaaatatttatgttttcccttgtttttctagttgaaattttgcctaagaaattaa |
599610 |
T |
 |
| Q |
101 |
cgtttctatttttatatgaacatgcnnnnnnnnnnnnnnnnnnnnnnggaaggcatggaattcagggtgaatggatatgtatctttcaatggaaagagtt |
200 |
Q |
| |
|
|||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
599611 |
cgtttctactgttatatgaacatgc-ttttggttttttaatttttttggaaggcatggaattcagggtgaatggatatgtatctttcaatggaaagagtt |
599709 |
T |
 |
| Q |
201 |
gaaaattgagaaatttccacatgtggtaggtgtgcctttctattgtcccttagccacttccat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
599710 |
gaaaattgagaaatttccacatgtggtaggtgtgcctttctattgtcccttagccacttccat |
599772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 148 - 263
Target Start/End: Original strand, 590522 - 590645
Alignment:
| Q |
148 |
ggaaggcatggaattcagggtgaatggatatgtatctttcaa--tggaaagagttgaaaattgagaaatttccacat-----gtggtaggtgtgcctttc |
240 |
Q |
| |
|
|||||| ||| ||||||||||||||||| ||||| ||| ||| |||||||||||||||||||||||| |||||||| |||||||||||| ||||| |
|
|
| T |
590522 |
ggaaggtatgcaattcagggtgaatgga-atgtaccttccaaaatggaaagagttgaaaattgagaaacttccacatgtttagtggtaggtgtgtctttc |
590620 |
T |
 |
| Q |
241 |
tattgtcc--cttagccacttccat |
263 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
590621 |
tattgtcctttttagccacttccat |
590645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University