View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16042_high_8 (Length: 352)
Name: NF16042_high_8
Description: NF16042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16042_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 18 - 334
Target Start/End: Original strand, 35870040 - 35870346
Alignment:
| Q |
18 |
atatcggacaaactttcaacaaaagatagtttggccacctgtgaaattattttttgactatgcagtttttaggagtgtttggactacaattttgcattgg |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35870040 |
atatcggacaaattttcaacaaaagatagtttggccacctgtgaaattattttttgactatgcggtttttaggagtgtttggactacaattttgcattgg |
35870139 |
T |
 |
| Q |
118 |
taacatgtctcttgcgctctttcaaaggactctatacactaacgctcatcaatttggtggtttatatgtctctaataacatggttaaaagatgttttaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35870140 |
taacatgtctcttgcgctctttcaaaggactctatacactaacgctcatcaatttggtggtttatatgtctctaataacatggttaaaagatgttttaga |
35870239 |
T |
 |
| Q |
218 |
caatctgatttgtttgtatttaggtgatatggaaagaacctaacaaccatgattttggtcataaggtatcaactctttctcttatgcttgataaaattga |
317 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35870240 |
caatctaatttg----------ggtgatatggaaagaacctaacaaccatgattttggtcataaggtatcaactctttctcttatgcttgctaaaattga |
35870329 |
T |
 |
| Q |
318 |
gattggggtgcaatggc |
334 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
35870330 |
gattagggtgcaatggc |
35870346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University