View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16042_low_11 (Length: 305)
Name: NF16042_low_11
Description: NF16042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16042_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 134 - 289
Target Start/End: Complemental strand, 1203618 - 1203463
Alignment:
| Q |
134 |
cagtgtgattcaggtgatgattcgggtccgatttcatacaaccctttggatgaaccaagtccacttggtttgcgtttgaagaagagtccatcacttttgg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1203618 |
cagtgtgattcaggtgatgattcgggtccgatttcatacaaccctttggatgaaccaagtccacttggtttgcgtttgaagaagagtccatcacttttgg |
1203519 |
T |
 |
| Q |
234 |
atttgattcagatgaagctttcacaaacttatgaatctaagaagaaagatcagaag |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1203518 |
atttgattcagatgaagctttcacaaacttatgaatccaagaagaaagatcagaag |
1203463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 48
Target Start/End: Complemental strand, 1203732 - 1203704
Alignment:
| Q |
20 |
tcaatctttttgttaatttcatattgggt |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1203732 |
tcaatctttttgttaatttcatattgggt |
1203704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University