View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16042_low_15 (Length: 235)
Name: NF16042_low_15
Description: NF16042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16042_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 5 - 99
Target Start/End: Original strand, 7278455 - 7278549
Alignment:
| Q |
5 |
ccaaacttgttcccacactttcttccttctcttctacctccatcttcttcacatcctcattgctctcctcattccccaaagcttcaaatttttca |
99 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7278455 |
ccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgttctcctcattccccaaagcttcaaatttttca |
7278549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 5 - 99
Target Start/End: Complemental strand, 7375384 - 7375290
Alignment:
| Q |
5 |
ccaaacttgttcccacactttcttccttctcttctacctccatcttcttcacatcctcattgctctcctcattccccaaagcttcaaatttttca |
99 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7375384 |
ccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgttctcctcattccccaaagcttcaaatttttca |
7375290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 7278608 - 7278677
Alignment:
| Q |
158 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaattatattcttc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
7278608 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaatgatcttcttc |
7278677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 158 - 227
Target Start/End: Complemental strand, 7375231 - 7375162
Alignment:
| Q |
158 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaattatattcttc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
7375231 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaatgatcttcttc |
7375162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University