View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16043_high_4 (Length: 223)
Name: NF16043_high_4
Description: NF16043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16043_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 33050129 - 33050290
Alignment:
| Q |
18 |
aaaaggaaatacaagaaaggaaagaattattggaatgataatgcttccaagaatgatgaaggttcaagtaaaaataaagaaagcttcgagaaagaatgag |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
33050129 |
aaaaggaaatgcaagaaaggaaagaattattggaatgataaagcttccaagaatgattaaggtt-------aaataaagaaagcttcgagaaagaaggag |
33050221 |
T |
|
| Q |
118 |
attcaatgatataatcttaaaaaatgggggcattatgtatctgaatgcaagtccaagaaagttccaagg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33050222 |
attcaatgatataatcttaaaaaatgggggcattatgtatctgaattcaagtccaagaaagttccaagg |
33050290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 184
Target Start/End: Complemental strand, 28451933 - 28451893
Alignment:
| Q |
144 |
ggggcattatgtatctgaatgcaagtccaagaaagttccaa |
184 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
28451933 |
ggggcattatgcatctgaatgcaagtctaagaaagttccaa |
28451893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University