View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16044_low_2 (Length: 321)
Name: NF16044_low_2
Description: NF16044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16044_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 183 - 306
Target Start/End: Original strand, 3635359 - 3635482
Alignment:
| Q |
183 |
ctgttggtttatatatgatcagtatttggccagactcactgttgtatgcagcaatatatggtgctgttgaatctgcttccattgcattgtttggtccttt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3635359 |
ctgttggtttatatatgatcagtatttggccagactcactgttgtatgcagcaatatatggggctgttgaatctgcttccattgcattgtttggtccttt |
3635458 |
T |
 |
| Q |
283 |
gattggaacatgggttgataagtt |
306 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3635459 |
gattggaacatgggttgataagtt |
3635482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 183 - 306
Target Start/End: Original strand, 3644791 - 3644914
Alignment:
| Q |
183 |
ctgttggtttatatatgatcagtatttggccagactcactgttgtatgcagcaatatatggtgctgttgaatctgcttccattgcattgtttggtccttt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3644791 |
ctgttggtttatatatgatcagtatttggccagactcactgctctatgcagcaatatatggtgctgttgaatctgcttccattgcattgtttggtcccat |
3644890 |
T |
 |
| Q |
283 |
gattggaacatgggttgataagtt |
306 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3644891 |
aattggaacatgggttgataagtt |
3644914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 27 - 119
Target Start/End: Original strand, 3644634 - 3644726
Alignment:
| Q |
27 |
ctttaatttcttgaggaaaaaggttgaactgaaactattggttttgtctttatgaaatcataattttatgaaatggaacaaaaagggatcacc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3644634 |
ctttaatttcttgaggaaaaaggttgaactgaaactattggttttgtctttatgaaatcataattttatgaaatggaacaaaaagggatcacc |
3644726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University