View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16044_low_3 (Length: 263)
Name: NF16044_low_3
Description: NF16044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16044_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 42516728 - 42516495
Alignment:
| Q |
18 |
tggcaagcatattctatgaatcaactaataaaaatgattgatatacaaattattgtgattaattatttgcaataatagagaggctgatttatggaatagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42516728 |
tggcaagcatattctatgaatcaactaaaataaatgattgatatacaaattattgtgattaattatttgcaataatagagaggctgatttatggaatagt |
42516629 |
T |
|
| Q |
118 |
gattgctcctttacaggttaagggtgaggaatgtcagaataattgagcaacaagaaatatcaaacaccctctttgacactcattttcattgcaagacaag |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42516628 |
gattgctcctttacaggtcaagggtgaggaatgtcagaataatcgagcaacaagaaataacaaacaccctctttgacactcattttcattgcaagacaag |
42516529 |
T |
|
| Q |
218 |
tctcaatgccagtgtcgaaactaccttcatttct |
251 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
42516528 |
tctcaatgccagtgtcgaaactaccttgatttct |
42516495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University