View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16044_low_5 (Length: 249)
Name: NF16044_low_5
Description: NF16044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16044_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 24513373 - 24513134
Alignment:
| Q |
1 |
tattgtctctaacaggttaaagatccctaaacttgattatgtttaatttgcttcaaaagggatatataacctcacgtaaaagttaaaggatacttccaat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
24513373 |
tattgtctctaacatgttaaagatccctaaacttgattatgtttaatttgcttcaaaagggatacataacctcacgtaaaagttaaaggatacttcctat |
24513274 |
T |
|
| Q |
101 |
tgcttatagttgattaagtacgttcaaagacttttgaaatttcgaatctctttattctctcaccattttcgatttatattgacgagttttta-tctcttc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
24513273 |
tgcttatagttgattaagtacgttcaaagacttttgaaatttcgaatctctttgttctctcaccattttcgatttgtattgacgagtttttattctcttc |
24513174 |
T |
|
| Q |
200 |
atcttctatttttgtcccttcgatttcaagtggtattcat |
239 |
Q |
| |
|
|| |||||||||||| |||||||||| |||| |||||||| |
|
|
| T |
24513173 |
attttctatttttgttccttcgattttaagtagtattcat |
24513134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University