View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16045_high_6 (Length: 301)
Name: NF16045_high_6
Description: NF16045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16045_high_6 |
 | |
|
| [»] scaffold0489 (1 HSPs) |
| | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 6 - 286
Target Start/End: Original strand, 13993049 - 13993329
Alignment:
| Q |
6 |
tattctgtcctccttcactagaaccggatcctgttaaaaccataatggagtttcctgaatttgttgtctcgactgaattttcgggttttttcatccactt |
105 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13993049 |
tattctgtcctccttccctagaaccggatcctgttactaccataatggagtttcctgaatttgttgtctcgactgaattttcgggttttttcatccactt |
13993148 |
T |
|
| Q |
106 |
ttcgagtaatctagctatgttttcggtatttgatgcataaggggaagtttgattttcagctaaaataggtgttggcttgtcaagagaaagtgcctcacac |
205 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13993149 |
ttcgagtaatctagctatgttttcggtgtttgatgcataaggggatgtttgattttcagctaaaataggtgttggcttgtcaagagaaagtgcctcacac |
13993248 |
T |
|
| Q |
206 |
aaagcttgttttgccatatgaatatctgtttgaagtcttctctcccattgaccttttacttgaggaatagagttttcttct |
286 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13993249 |
aaagcttgttttgccatatggatatctgtttgaagtcttctctcccattgaccttttacttgaggaatagagttttcttct |
13993329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0489 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0489
Description:
Target: scaffold0489; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 209 - 261
Target Start/End: Original strand, 10132 - 10184
Alignment:
| Q |
209 |
gcttgttttgccatatgaatatctgtttgaagtcttctctcccattgaccttt |
261 |
Q |
| |
|
|||||||| |||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
10132 |
gcttgtttggccatatgaatatctgtttgtagccttctttcccattgaccttt |
10184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 209 - 261
Target Start/End: Complemental strand, 10896 - 10844
Alignment:
| Q |
209 |
gcttgttttgccatatgaatatctgtttgaagtcttctctcccattgaccttt |
261 |
Q |
| |
|
|||||||| |||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
10896 |
gcttgtttggccatatgaatatctgtttgtagccttctttcccattgaccttt |
10844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 209 - 259
Target Start/End: Complemental strand, 2461728 - 2461678
Alignment:
| Q |
209 |
gcttgttttgccatatgaatatctgtttgaagtcttctctcccattgacct |
259 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2461728 |
gcttttttggccatttgaatatctgtttgaagtcttctttcccattgacct |
2461678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University