View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16045_high_7 (Length: 261)
Name: NF16045_high_7
Description: NF16045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16045_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 9 - 246
Target Start/End: Original strand, 30949248 - 30949485
Alignment:
| Q |
9 |
agggaattggaatggatgtgaataatttatcgtacctaacaatcttgaacgaagctattgaataagatgaatcttagaatgttgatttgaggatgaagct |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30949248 |
agggaactggaatggatgtgaataatttatcgtacctaacaatcttgaacgaagctattgaataagatgaatcttagaatgttgatttgaggatgaagct |
30949347 |
T |
 |
| Q |
109 |
gtgagattccaaatatatttgtcaggtcaactcaagatgtcgtcttcaaacttttcctgggtttttggaagggatattagaagatgaaatatagtaaagg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30949348 |
gtgagattccaaatatatttgtcaggtcaactcaagatgtcgtcttcaaacttttcctgggtttttggaagggatattagaagatgaaatatagtaaagg |
30949447 |
T |
 |
| Q |
209 |
attatggatgatacatggtcttaaattagtgtgaaaac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30949448 |
attatggatgatacatggtcttaaattagtgtgaaaac |
30949485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University