View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16046_high_13 (Length: 299)
Name: NF16046_high_13
Description: NF16046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16046_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 281
Target Start/End: Original strand, 30603833 - 30604103
Alignment:
| Q |
10 |
aaatgaataaggtagatgaagtaatgaagttattgcatgccatggaagagcataaaatcaatgctgataatttcacccactcaatcattttttatgcttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30603833 |
aaatgaataaggtagatgaagtaatgaagttattacctaccatggaagagcataaaatcaatgctgataatttcaccaactcaatcattttttatgcttt |
30603932 |
T |
 |
| Q |
110 |
gtgctgcaaaagaaatagaatggagattgcacttaaaatgtttaaagaccttttgaagaaatgtgtcacttttaattttgtggtatacaacactatgatc |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
30603933 |
gtgctacaaaagaaatagaatggagattgcactttaaatgtttaaa-acattttgaagaaatgtgttacttttaattttgtggtatacaactctatgatc |
30604031 |
T |
 |
| Q |
210 |
aatggattttgcttgagaaacttgaccaatgatgctttgaaattgatttcaaaaatgaaagagaatggttgc |
281 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
30604032 |
aatggattctgcttgagaaaattgatcaatgatgctttgaaattgtttccaaaaatgaaagagaatggttgc |
30604103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University