View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16046_high_23 (Length: 219)
Name: NF16046_high_23
Description: NF16046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16046_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 18013544 - 18013730
Alignment:
| Q |
17 |
gaagctcactaaggaccattttgtatgcaaatcgagtaaacttgcaattaaatatcaaaatttcaattatacaaatataactatacactgaatcatgcaa |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18013544 |
gaagctcaccaaggaccattttgtatgcaaatcgagtaaacttgcaattaaataccaaaatttcaattatacaaatataattatacactgaatcatgcaa |
18013643 |
T |
 |
| Q |
117 |
ataaacttatcaatcacaaaaatttcctagacatagcagtttaacaaatgtaagcaactgaagacaaaatttccacatgaaagttct |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
18013644 |
ataaacttatcaatcacaaaaaattcctagacgtagcagtttaacaaatgtaagcaactgaagaaaaaatttccgcatgaaagttct |
18013730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University