View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16046_high_8 (Length: 456)
Name: NF16046_high_8
Description: NF16046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16046_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 90 - 333
Target Start/End: Complemental strand, 34431075 - 34430830
Alignment:
| Q |
90 |
tatcattatagaaattattctttttgagtgaagtacaatctacgacttcatgatttgcttattattgttttgcttttcttttgttgatatgaattatgtt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34431075 |
tatcattatagaaattattctttttgagggaagtacaatctacgacttcatgatttgcttattattgttttgcttttattttgttgatatgaattatgtt |
34430976 |
T |
|
| Q |
190 |
gcttattgtgttgataattgtttttgcatgtcaatggataggtaaaggtattttgtattatatgtaatgtgatgcaaatatgtcttttatgggaa--ata |
287 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||| |
|
|
| T |
34430975 |
gcttattgtgttgataattgtttttgcgtgtcaatggataggtaaaggtattttgtattatatgtgatgtgatgcaaatatgtcttttatggaaaatata |
34430876 |
T |
|
| Q |
288 |
tatgtctcattagataattcaataaattgaagattgtgtttccata |
333 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34430875 |
tatgtctcattacataattcaataaattgaagattgtgtttccata |
34430830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 34431187 - 34431098
Alignment:
| Q |
1 |
acaaattgtgatcaatcacttagtctgtgtgtgcagttcttttctgaagaacttagtttgtgtttgtagttcttcttcaccatatttttt |
90 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431187 |
acaaattgtgatcaatcacttagtttgtgtgtgtagttcttttctgaagaacttagtttgtgtttgtagttcttcttcaccatatttttt |
34431098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 395 - 440
Target Start/End: Complemental strand, 34430765 - 34430720
Alignment:
| Q |
395 |
atcatggcttatgttataagtagaaagttttcaccatcgttacaca |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34430765 |
atcatggcttatgttataagtagaaagttttcaccatcgttacaca |
34430720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University