View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16046_low_12 (Length: 318)
Name: NF16046_low_12
Description: NF16046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16046_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 17 - 310
Target Start/End: Complemental strand, 47009799 - 47009506
Alignment:
| Q |
17 |
acttagcacattcataactcttttgcgtttatgtagttttcaattttcggttcaatattaaccattggagcaatgatcggtgccattgttagtggtacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47009799 |
acttagcacattcataactcttttgcgtttatgtagttttcaattttcggttcaatattaaccattggagcaatgatcggtgccattgttagtggtacaa |
47009700 |
T |
 |
| Q |
117 |
tagcagactacgctggtcgacgtcttgtaagtttcaatcatggctgcattttattttaaactcaatgttgctgtttttcaacttaattaatttggttatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47009699 |
tagcagactacgctggtcgacgtcttgtaagtttcaatcatgtctgcattttattttaaactcaatgtttctgtttttcaacttaattaatttggttatt |
47009600 |
T |
 |
| Q |
217 |
ttgtaatatactgggcaggccatgggattctcgcagctattctgcatttcgggatggcttgccattacaatcgcaaaggtctgccattcatttc |
310 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47009599 |
ttgtaatatgctgggcaggccatgggattctcgcagctattctgcatttcgggatggcttgccattacaatcgcaaaggtctgccattcatttc |
47009506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 44 - 135
Target Start/End: Complemental strand, 47003946 - 47003855
Alignment:
| Q |
44 |
tttatgtagttttcaattttcggttcaatattaaccattggagcaatgatcggtgccattgttagtggtacaatagcagactacgctggtcg |
135 |
Q |
| |
|
|||||| ||| |||| |||| ||||||||| |||| |||||||||||| | ||||||||||| ||||||| ||||||| ||||| ||||| |
|
|
| T |
47003946 |
tttatgcagtattcactttttggttcaatactaacaattggagcaatggttggtgccattgtaagtggtagtttagcagattacgcaggtcg |
47003855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 47003756 - 47003708
Alignment:
| Q |
233 |
aggccatgggattctcgcagctattctgcatttcgggatggcttgccat |
281 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| | ||||||||||||||| |
|
|
| T |
47003756 |
aggccatgggattctccgagctattttgcatcttgggatggcttgccat |
47003708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University