View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16046_low_18 (Length: 253)
Name: NF16046_low_18
Description: NF16046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16046_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 238
Target Start/End: Original strand, 29422834 - 29423065
Alignment:
| Q |
7 |
agatgaatatagtggctttttaagtccaaatatagtgtaactcaaatcccttatgaccaaatataatcaaacatcattatgtgttttccctctaactatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29422834 |
agatgaatatagtggctttttaagtccaaatatagtgtaactcaaatcccttatgaccaaatataatcaaacatcattatgtgttttccctctaactatt |
29422933 |
T |
|
| Q |
107 |
attacgtgcaggaaagattttcgagactatgcggagctttgctttaaagaatttggggatagagtaaaacattggatcacactgaatgaaccatgggcct |
206 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29422934 |
actatatgcaggaaagattttcgagactatgcggagctttgctttaaagaattcggggacagagtaaaacattggatcacactgaatgaaccatgggcct |
29423033 |
T |
|
| Q |
207 |
ttgccaaacatgcttatgctgagggaagtttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29423034 |
ttgccaaacatgcttatgctgagggaagtttc |
29423065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 115 - 224
Target Start/End: Complemental strand, 29460131 - 29460022
Alignment:
| Q |
115 |
caggaaagattttcgagactatgcggagctttgctttaaagaatttggggatagagtaaaacattggatcacactgaatgaaccatgggcctttgccaaa |
214 |
Q |
| |
|
|||||| ||||||| |||||||| |||||||| |||||||||||||| ||||| ||||| |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
29460131 |
caggaatgattttcaagactatgtagagctttgttttaaagaatttggagatagggtaaagcattggatcacattgaatgaaccatggacctttgccaaa |
29460032 |
T |
|
| Q |
215 |
catgcttatg |
224 |
Q |
| |
|
|||| ||||| |
|
|
| T |
29460031 |
catggttatg |
29460022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 7 - 84
Target Start/End: Complemental strand, 29460257 - 29460180
Alignment:
| Q |
7 |
agatgaatatagtggctttttaagtccaaatatagtgtaactcaaatcccttatgaccaaatataatcaaacatcatt |
84 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| || |||||| |||||| | ||||||| |||||| |
|
|
| T |
29460257 |
agatgaatatggtggctttttaagtccaaatatagtgtaactcacattccttataaccaaagaaaatcaaatatcatt |
29460180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 116 - 202
Target Start/End: Original strand, 29406197 - 29406283
Alignment:
| Q |
116 |
aggaaagattttcgagactatgcggagctttgctttaaagaatttggggatagagtaaaacattggatcacactgaatgaaccatgg |
202 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| | ||| ||||| || ||||| || || |||||||||||| |||| || |||||| |
|
|
| T |
29406197 |
aggaatgattttcgagactatgcagagctttgttataaggaattcggagatagggtgaagcattggatcacattgaacgagccatgg |
29406283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 119 - 202
Target Start/End: Complemental strand, 25180478 - 25180395
Alignment:
| Q |
119 |
aaagattttcgagactatgcggagctttgctttaaagaatttggggatagagtaaaacattggatcacactgaatgaaccatgg |
202 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||||| |||||||||||||||||||| || ||||||| |||||| |
|
|
| T |
25180478 |
aaagattttcaagactatgcggaactttgctttaaaacatttggagatagagtaaaacattggataactttgaatgagccatgg |
25180395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 109 - 202
Target Start/End: Complemental strand, 25168820 - 25168727
Alignment:
| Q |
109 |
tacgtgcaggaaagattttcgagactatgcggagctttgctttaaagaatttggggatagagtaaaacattggatcacactgaatgaaccatgg |
202 |
Q |
| |
|
||||| ||| ||||| |||| |||||||||||| |||||||| ||| |||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
25168820 |
tacgtacagaaaagactttcaagactatgcggaactttgcttcaaaacatttggagatagagtaaaacattggataactttgaatgaaccatgg |
25168727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 119 - 202
Target Start/End: Original strand, 25252456 - 25252539
Alignment:
| Q |
119 |
aaagattttcgagactatgcggagctttgctttaaagaatttggggatagagtaaaacattggatcacactgaatgaaccatgg |
202 |
Q |
| |
|
||||| |||| |||||||||||| |||||||| ||| |||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
25252456 |
aaagactttcaagactatgcggaactttgcttcaaaacatttggagatagagtaaaacattggataactttgaatgaaccatgg |
25252539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 122 - 202
Target Start/End: Original strand, 25000770 - 25000850
Alignment:
| Q |
122 |
gattttcgagactatgcggagctttgctttaaagaatttggggatagagtaaaacattggatcacactgaatgaaccatgg |
202 |
Q |
| |
|
|||||| | |||||||| || |||||||| || |||||||| ||||| || ||||||||||| || |||||||||||||| |
|
|
| T |
25000770 |
gattttagggactatgctgaactttgcttcaaggaatttggcgatagggtgaaacattggattactttgaatgaaccatgg |
25000850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 122 - 171
Target Start/End: Complemental strand, 25189420 - 25189371
Alignment:
| Q |
122 |
gattttcgagactatgcggagctttgctttaaagaatttggggatagagt |
171 |
Q |
| |
|
||||||||||||||||| || |||||||| || |||||||| |||||||| |
|
|
| T |
25189420 |
gattttcgagactatgctgatctttgcttcaaggaatttggagatagagt |
25189371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 171
Target Start/End: Complemental strand, 25160249 - 25160197
Alignment:
| Q |
119 |
aaagattttcgagactatgcggagctttgctttaaagaatttggggatagagt |
171 |
Q |
| |
|
|||||||||| |||||||||||| ||||| || || |||||||| |||||||| |
|
|
| T |
25160249 |
aaagattttcaagactatgcggaactttgtttcaaggaatttggtgatagagt |
25160197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University