View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16046_low_22 (Length: 228)
Name: NF16046_low_22
Description: NF16046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16046_low_22 |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 212
Target Start/End: Original strand, 10469254 - 10469457
Alignment:
| Q |
9 |
tagattattcttattccaaacaaaattctctttttcagcttccaaaaaacaaatctagaagggttccgatcaacaactccagaaaacggttaccatccgg |
108 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10469254 |
tagattattattattccaaacaaaattctctttttcagcttccaaaaaacaaatctagaagggttccgatcaacaactccagaaaacggttactatccgg |
10469353 |
T |
 |
| Q |
109 |
cagctgtcggaagaaaagagatgagcggcggcatgttggttagtgttggttgcgggatggtggagttcgctcatgacgctgacggcaacgaagaatggtg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10469354 |
cagctgtcggaagaaaagagatgagcggcgtcgtgttggttagtgttggttgcgggatggtggagttcgctcatgacgctgacggcaacgaagaatggtg |
10469453 |
T |
 |
| Q |
209 |
tgtg |
212 |
Q |
| |
|
|||| |
|
|
| T |
10469454 |
tgtg |
10469457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 212
Target Start/End: Complemental strand, 52102988 - 52102785
Alignment:
| Q |
9 |
tagattattcttattccaaacaaaattctctttttcagcttccaaaaaacaaatctagaagggttccgatcaacaactccagaaaacggttaccatccgg |
108 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52102988 |
tagattattattattccaaacaaaattctctttttcagcttccaaaaaacaaatctagaagggttccgatcaacaactccagaaaacggttatcatccgg |
52102889 |
T |
 |
| Q |
109 |
cagctgtcggaagaaaagagatgagcggcggcatgttggttagtgttggttgcgggatggtggagttcgctcatgacgctgacggcaacgaagaatggtg |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52102888 |
caactgtcggaagaaaagagatgagcggcgacgtgttggttagtgttggttgcgggatggtggagttcgctcatgacgctgacggcaacgaagaatggtg |
52102789 |
T |
 |
| Q |
209 |
tgtg |
212 |
Q |
| |
|
|||| |
|
|
| T |
52102788 |
tgtg |
52102785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 142 - 212
Target Start/End: Complemental strand, 44311718 - 44311648
Alignment:
| Q |
142 |
tgttggttagtgttggttgcgggatggtggagttcgctcatgacgctgacggcaacgaagaatggtgtgtg |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
44311718 |
tgttggttgatgttggttgcgggatggtggagtttgctcatgacgccgacgacgacgaagaatggtgtgtg |
44311648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 9 - 212
Target Start/End: Complemental strand, 42149133 - 42148937
Alignment:
| Q |
9 |
tagattattcttattccaaacaaaattctctttttcagcttccaaaaaacaaatctagaagggttccgatcaacaactccagaaaacggttaccatccgg |
108 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
42149133 |
tagattattattattccaaacaaaattctctttttcagctttcaaaaaacaaatctagaagggttccgatcaacaactccagaaaacggtgaccgtccgg |
42149034 |
T |
 |
| Q |
109 |
cagctgtcggaagaaaagagatgagcggcggcatgttggttagtgttggttgcgggatggtggagttcgct---catgacgctgacggcaacgaagaatg |
205 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
42149033 |
cagctatcggaagaaaagaggtgagcggcggc----------gtgttggttgcgggatggtggagtgatattagcatgacgctgacagcaacgaagaatg |
42148944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 133 - 193
Target Start/End: Complemental strand, 17938522 - 17938462
Alignment:
| Q |
133 |
gcggcggcatgttggttagtgttggttgcgggatggtggagttcgctcatgacgctgacgg |
193 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
17938522 |
gcggcggcgggttcgttagtgttggtagcgggatggtggggttcgctcatgacgctgacgg |
17938462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 59
Target Start/End: Complemental strand, 29125911 - 29125864
Alignment:
| Q |
12 |
attattcttattccaaacaaaattctctttttcagcttccaaaaaaca |
59 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29125911 |
attattattattccaaacaaaattctctttttcaacttccaaaaaaca |
29125864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 193
Target Start/End: Complemental strand, 36382667 - 36382617
Alignment:
| Q |
143 |
gttggttagtgttggttgcgggatggtggagttcgctcatgacgctgacgg |
193 |
Q |
| |
|
||||| |||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
36382667 |
gttggctagtgttggtagcgggatggtgggattcgctcatgacgctgacgg |
36382617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 184
Target Start/End: Original strand, 19102 - 19153
Alignment:
| Q |
133 |
gcggcggcatgttggttagtgttggttgcgggatggtggagttcgctcatga |
184 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
19102 |
gcggcggcaggttggttagtgttggaagcgggatggtggggttcgctcatga |
19153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 147 - 193
Target Start/End: Complemental strand, 4127028 - 4126982
Alignment:
| Q |
147 |
gttagtgttggttgcgggatggtggagttcgctcatgacgctgacgg |
193 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||||||||||| |
|
|
| T |
4127028 |
gttagtgttggtagcgggaaggtggggttcgctcatgacgctgacgg |
4126982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 190
Target Start/End: Original strand, 5960716 - 5960763
Alignment:
| Q |
143 |
gttggttagtgttggttgcgggatggtggagttcgctcatgacgctga |
190 |
Q |
| |
|
||||| |||||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
5960716 |
gttggctagtgttggtagcgggatggtggggttctctcatgacgctga |
5960763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 193
Target Start/End: Original strand, 43845609 - 43845669
Alignment:
| Q |
133 |
gcggcggcatgttggttagtgttggttgcgggatggtggagttcgctcatgacgctgacgg |
193 |
Q |
| |
|
|||||||| ||| |||||||||||| || ||||||||| |||| ||||||| |||||||| |
|
|
| T |
43845609 |
gcggcggcgggttcgttagtgttggtagcaggatggtggggttcactcatgatgctgacgg |
43845669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 190
Target Start/End: Complemental strand, 6826905 - 6826858
Alignment:
| Q |
143 |
gttggttagtgttggttgcgggatggtggagttcgctcatgacgctga |
190 |
Q |
| |
|
||||| |||||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
6826905 |
gttggctagtgttggtagcgggatggtggggttctctcatgacgctga |
6826858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University