View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16047_high_15 (Length: 246)
Name: NF16047_high_15
Description: NF16047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16047_high_15 |
 |  |
|
| [»] scaffold0391 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0391 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: scaffold0391
Description:
Target: scaffold0391; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 11086 - 11325
Alignment:
| Q |
1 |
tgccaattcaatgtctggttcaattttaaaaactttagttttaacatattaaagaagcattttactttgcttggttaaaattgattttcttttttgatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11086 |
tgccaattcaatgtctggttcaattttaaaaactttggttttaacatattaaagaagcattttactttgcttggttaaaattgattttcttttttgatga |
11185 |
T |
 |
| Q |
101 |
gtattcatttagttgagcatgtaaaatgtagtaatatattattttgtggtagcacataaacataatgatggttaccttcaacacatgcattttaaaatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11186 |
gtattcatttagttgagcatgtaaaatgtagtaatatattattttgtggtagcacataaacataatgatggttaccttcaacacatgcattttaaaatgg |
11285 |
T |
 |
| Q |
201 |
tacaaggcatcaaattctctggtcttacaattgtcctttg |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11286 |
tacaaggcatcaaattctcttgtcttacaattgtcctttg |
11325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University