View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16047_low_14 (Length: 279)
Name: NF16047_low_14
Description: NF16047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16047_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 45 - 267
Target Start/End: Complemental strand, 33362945 - 33362739
Alignment:
| Q |
45 |
caaagaaattaagtttaagtactaattaatgatattttgattctaacccttcacatagttcaaaatatattgccatgcttttcacccattaactataggc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33362945 |
caaagaaattaagtttaagtactaattaatgatattttgattctaacccttcacatagttcaaaatatattgtcatgcttttcacccattaactataggc |
33362846 |
T |
 |
| Q |
145 |
ataaaattaagggtaacatgataaggctcaaataatcacccatctccttgnnnnnnnngctagatgaaattgagattttaaattcattattatttgctga |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33362845 |
ataaaattaagggtaacatgataaagctcaaataatcacccatctcct----------------tgaaattgagattttgaattcattattatttgctga |
33362762 |
T |
 |
| Q |
245 |
attaatcacaatgtaagtcattt |
267 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33362761 |
attaatcacaatgtaagtcattt |
33362739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University