View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16048_high_2 (Length: 296)
Name: NF16048_high_2
Description: NF16048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16048_high_2 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 98 - 296
Target Start/End: Complemental strand, 13919780 - 13919582
Alignment:
| Q |
98 |
ttacaaattttggttgcaccttcctttcaaaaaatgaaacgaaaaatacaagtttggaactttcaactatctaataattacgtatacgcaattcctttct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919780 |
ttacaaattttggttgcaccttcctttcaaaaaatgaaacgaaaaatacaagtttggaactttcaactatctaataattacgtatacgcaattcctttct |
13919681 |
T |
 |
| Q |
198 |
tggattaaaatacattcacaccaaaaatgcctgctttgctgtcacaaacagtcaaagtcccgatttgtaaaaacatttaacatgtttaatgtttttcat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919680 |
tggattaaaatacattcacaccaaaaatgcctgctttgctgtcacaaacagtcaaagtcccgatttgtaaaaacatttaacatgtttaatgtttttcat |
13919582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University