View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16048_low_2 (Length: 319)
Name: NF16048_low_2
Description: NF16048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16048_low_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 47 - 319
Target Start/End: Complemental strand, 21299310 - 21299038
Alignment:
| Q |
47 |
ccctaaacagatttggccccccttgttgtagtacattgcaactagcttaatgttcatttatattttgtataagttgtcatggttttgtggtgtggattga |
146 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21299310 |
ccctaaatagatttggtcccccttgttgtagtacattgcaactagcttaatgttcatttatattttgtataagttgtcatggatttgtggtgtggattga |
21299211 |
T |
 |
| Q |
147 |
aaatcaaccaaacattctaattcatagcggtgttgaaattatctatgcaatgtagaccaaagaaaaaccatatatatgacatgatgctgattacataatc |
246 |
Q |
| |
|
||||||||| ||||||| |||||||||| |||||||||||||| |||||||||| ||||||||||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
21299210 |
aaatcaaccgaacattccaattcatagcagtgttgaaattatcagtgcaatgtaggccaaagaaaaatcatgtatatgacctgatgctgattacataatt |
21299111 |
T |
 |
| Q |
247 |
tgaattgtgtcaaacacctaatgcattagtttttcaacagttcgtgcatgttttggattatacaatctaaacc |
319 |
Q |
| |
|
||||||| ||||||||| ||| ||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
21299110 |
tgaattgcatcaaacacccaatacattagtttttcaacggtttatgcatgttttggattatacaatctaaacc |
21299038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University