View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16048_low_6 (Length: 206)
Name: NF16048_low_6
Description: NF16048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16048_low_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 8536756 - 8536961
Alignment:
| Q |
1 |
accatataatgagatccataacatcaaatagaattcagttagtttgaagatcaatctcaagtttaatgatactcaaaataacaaaagataaactagccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8536756 |
accatataatgagatccataacatcaaatagaattcggttagtttgaagatcaatctcaagtttaatgatactcaaaataacaaaagataaactagccca |
8536855 |
T |
 |
| Q |
101 |
ctatagcatattttaccaaaatgataaaatatgtaatcaaagaaacaaaataagtaggtccacagttatagaaacggatgcaaagaaaattggtaaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8536856 |
ctatagcatattttaccaaaatgataaaatatgtaatcaaagaaacaaaataagtaggtccacagttatagaaacggatgcaaagaaaattggtaaaaaa |
8536955 |
T |
 |
| Q |
201 |
ctacta |
206 |
Q |
| |
|
|||||| |
|
|
| T |
8536956 |
ctacta |
8536961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University