View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16049_high_5 (Length: 266)
Name: NF16049_high_5
Description: NF16049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16049_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 43027639 - 43027887
Alignment:
| Q |
1 |
caccaaagtcatttccaaacaggctcggaagcataacaatgccctacaacgataaataaacatgaaacatacgacaatcaataaaaatatcgtgcgaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
43027639 |
caccaaagtcatttccaaacaggctcggaagcataacaatgccctacaaagataaataaacagttaacagacgacaatcaataaaaatatcgtgcgaaat |
43027738 |
T |
 |
| Q |
101 |
gagtcaagcaattcactaaacttactttctcatgatcaaaaggaacagagtatgtcctatacttcacccgcaactcattgacaattctctccagctgatc |
200 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43027739 |
gagtcaagcaatttactaaactaactttctcatgatcaaaaggaacagagtatgtcctatacttcaccggcaactcattgacaattctctccagctgatc |
43027838 |
T |
 |
| Q |
201 |
atcaggattgggatttagtggtgctgccacatgaaaacgcaagtaagtt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43027839 |
atcaggattgggatttagtggtgctgccacatgaaaacgcaagttagtt |
43027887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 185
Target Start/End: Original strand, 24468137 - 24468171
Alignment:
| Q |
151 |
tatgtcctatacttcacccgcaactcattgacaat |
185 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24468137 |
tatgtcctatatttcacccgcaactcattgacaat |
24468171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University