View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16049_high_6 (Length: 247)

Name: NF16049_high_6
Description: NF16049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16049_high_6
NF16049_high_6
[»] chr5 (2 HSPs)
chr5 (1-227)||(43027413-43027639)
chr5 (142-189)||(41395285-41395332)


Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 43027639 - 43027413
Alignment:
1 gaccagatcgaccggtatgcaactttggtggatcctaatcataacgagtttgagattttggttcagagaaacaactatggcatcttctttaccaaaggct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||     
43027639 gaccagatcgaccggtatgcaactttggtggatcctaatcataacgagtttgagattttggttcagagaaacaactgtggcatcttctttaccaaaggcc 43027540  T
101 ggcgtgctctacgcgacttttacaacataaaacacggttgttgggtaacattggtttttgtagggttagggaagttcaacatccgtatcgaagataggtg 200  Q
    ||| ||||||||||| |||||||||||||||||  |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
43027539 ggcatgctctacgcggcttttacaacataaaacttggttcttgggtaacattgatttttgtagggttagggaagttcaacatccgtatcgaagataggtg 43027440  T
201 gggcaccaaagtgagatgtccttcatt 227  Q
    |||||||||||||||||||||||||||    
43027439 gggcaccaaagtgagatgtccttcatt 43027413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 189
Target Start/End: Complemental strand, 41395332 - 41395285
Alignment:
142 tgggtaacattggtttttgtagggttagggaagttcaacatccgtatc 189  Q
    |||||||||||||| ||||||||||||| ||||||||| ||| |||||    
41395332 tgggtaacattggtctttgtagggttagtgaagttcaaaatcagtatc 41395285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University