View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16049_low_6 (Length: 247)
Name: NF16049_low_6
Description: NF16049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16049_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 43027639 - 43027413
Alignment:
| Q |
1 |
gaccagatcgaccggtatgcaactttggtggatcctaatcataacgagtttgagattttggttcagagaaacaactatggcatcttctttaccaaaggct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43027639 |
gaccagatcgaccggtatgcaactttggtggatcctaatcataacgagtttgagattttggttcagagaaacaactgtggcatcttctttaccaaaggcc |
43027540 |
T |
 |
| Q |
101 |
ggcgtgctctacgcgacttttacaacataaaacacggttgttgggtaacattggtttttgtagggttagggaagttcaacatccgtatcgaagataggtg |
200 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43027539 |
ggcatgctctacgcggcttttacaacataaaacttggttcttgggtaacattgatttttgtagggttagggaagttcaacatccgtatcgaagataggtg |
43027440 |
T |
 |
| Q |
201 |
gggcaccaaagtgagatgtccttcatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43027439 |
gggcaccaaagtgagatgtccttcatt |
43027413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 189
Target Start/End: Complemental strand, 41395332 - 41395285
Alignment:
| Q |
142 |
tgggtaacattggtttttgtagggttagggaagttcaacatccgtatc |
189 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
41395332 |
tgggtaacattggtctttgtagggttagtgaagttcaaaatcagtatc |
41395285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University