View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1604_low_2 (Length: 357)
Name: NF1604_low_2
Description: NF1604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1604_low_2 |
 |  |
|
| [»] scaffold0094 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 14 - 343
Target Start/End: Original strand, 47220474 - 47220803
Alignment:
| Q |
14 |
aggcgtgcagcagcggttcgaagtaacagggaaaaagatgctagtgcatacattttattgagaaaggacattttcagtcttaggatttgggtttcacact |
113 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47220474 |
aggcgtgcagcagcggttggaagtaatagggaaaaagatgctagtgcatacattttattgagaaaggacattttcagtcttaggatttgggtttcatact |
47220573 |
T |
 |
| Q |
114 |
tggtaagcacttctctgtaacgaagcttactgctagcctatcgcttagagccaagttttgaccgtgattgctcgtcacttcggggcgccttattccttca |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47220574 |
tggtaatcacttctctgtaacgaagcttactgctagcctatcgcttagagccaagttttgaccgtgattgctcgtcacttcggggcgccttattccttca |
47220673 |
T |
 |
| Q |
214 |
cccgagatccaaggcagtagaacacttaatcttgaaaatctgtcaagttaaaatcactagtaaaataattttgttcacccctttttcaaaattgctttca |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47220674 |
cccgagatccaaggcagtagaacacttaatcttgaaaacctgtcaagttaaaatcactagtaaaataattttgttcacccctttttcaaaattgctttca |
47220773 |
T |
 |
| Q |
314 |
gttcaaataaataatttaatttgttgttga |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47220774 |
gttcaaataaataatttaatttgttgttga |
47220803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 112 - 226
Target Start/End: Original strand, 27665 - 27779
Alignment:
| Q |
112 |
cttggtaagcacttctctgtaacgaagcttactgctagcctatcgcttagagccaagttttgaccgtgattgctcgtcacttcggggcgccttattcctt |
211 |
Q |
| |
|
|||||||||| |||| ||||| ||||||||||||||||||||||| |||||||||| || ||||| || ||||||||||||| ||||||||| |||| | |
|
|
| T |
27665 |
cttggtaagcgcttcactgtagtgaagcttactgctagcctatcgcctagagccaagcttcgaccgcgactgctcgtcacttctgggcgcctttttccgt |
27764 |
T |
 |
| Q |
212 |
cacccgagatccaag |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27765 |
cacccgagatccaag |
27779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University