View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16050_high_2 (Length: 316)
Name: NF16050_high_2
Description: NF16050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16050_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 175 - 308
Target Start/End: Original strand, 43418823 - 43418956
Alignment:
| Q |
175 |
gttatcgaatcccgtgaaatacaaggaggtcccaaggtagtagataggtggggtcaacccgattcaactaactctgttaatgctgtttcactcattgatc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| ||| |
|
|
| T |
43418823 |
gttatcgaatcccgtgaaatacaaggaggtcccaaggtagtagataggtggggtcaacccgattcaactaagtctgttaacgctgtttcactcattcatc |
43418922 |
T |
|
| Q |
275 |
gccaatccaacccagtacgttttctttctctgct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43418923 |
gccaatccaacccagtacgttttctttctctgct |
43418956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 30 - 113
Target Start/End: Original strand, 43418678 - 43418761
Alignment:
| Q |
30 |
gcaaccactttagagtgccctggttgtcctccacttcgagctttaacattcgacacacttggtcttatcaaaggtattattatc |
113 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
43418678 |
gcaaccactgtagagtgccctggttgtcctccacttcgagctttaacattcgatacacttggtcttatcaaaggtatcattatc |
43418761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University