View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16051_high_16 (Length: 221)

Name: NF16051_high_16
Description: NF16051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16051_high_16
NF16051_high_16
[»] chr8 (1 HSPs)
chr8 (19-209)||(37996499-37996695)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 37996499 - 37996695
Alignment:
19 aactttaaccaagaatcatatcttagatggggatcataatgataaccattagcatatcctacaaacactgtacagtatttgtttatgagccaagtaattt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37996499 aactttaaccaagaatcatatcttagatggggatcataatgataaccattagcatatcctacaaacactgtacagtatttgtttatgagccaagtaattt 37996598  T
119 aatgttttgttatcacatgt------ttatctgaatcgattctgtctagctagtagcatttccatcttaggcaacaaaagtctttaacttcttctca 209  Q
    ||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37996599 aatgttttgttatcacatgtttataattatctgaatcgattctgtctagctagtagcatttccatcttaggcaacaaaagtctttaacttcttctca 37996695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University