View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16051_low_13 (Length: 262)
Name: NF16051_low_13
Description: NF16051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16051_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 24 - 254
Target Start/End: Complemental strand, 35924049 - 35923819
Alignment:
| Q |
24 |
gctggtgttgataccaacttcactgtcactgccaaggctgctgaggataccgagtttggtgaactttatattatcaagtggactactctcttgattccac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35924049 |
gctggtgttgataccaacttcactgtcactgccaaggctgctgaggataccgagtttggtgaactttatattatcaagtggactactctcttgattccac |
35923950 |
T |
|
| Q |
124 |
ctacaactcttatcattattaacatggttggtgttgttgctggattttctgatgcacttaatggaggatatgagtcttggggacctctctttgggaaggt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35923949 |
ctacaactcttatcattattaacatggttggtgttgttgctggattttctgatgcacttaatggaggatatgagtcttggggacctctctttgggaaggt |
35923850 |
T |
|
| Q |
224 |
tttctttgccttctgggtgatttttcatctc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35923849 |
tttctttgccttctgggtgatttttcatctc |
35923819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 5126113 - 5125880
Alignment:
| Q |
20 |
gttagctggtgttgataccaacttcactgtcactgccaaggctgctgaggataccgagtttggtgaactttatattatcaagtggactactctcttgatt |
119 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| || || |||||||| ||| | |||||||||||||| ||||| ||||| ||||| || ||||| ||| |
|
|
| T |
5126113 |
gttagcaggtgttgatacaaacttcactgtcacagcaaaagctgctgatgatgcagagtttggtgaactatatatgatcaaatggacaacactcttaatt |
5126014 |
T |
|
| Q |
120 |
ccacctacaactcttatcattattaacatggttggtgttgttgctggattttctgatgcacttaatggaggatatgagtcttggggacctctctttggga |
219 |
Q |
| |
|
|| || |||| |||||||||||||||| | ||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||| ||| |||| | |
|
|
| T |
5126013 |
cctccaacaagtcttatcattattaaccttgttggtgttgtagctggattttctgatgcacttaatggtggatatgaatcttggggaccactcattggaa |
5125914 |
T |
|
| Q |
220 |
aggttttctttgccttctgggtgatttttcatct |
253 |
Q |
| |
|
| |||||||| || || ||||||||||||||||| |
|
|
| T |
5125913 |
aagttttcttcgcattttgggtgatttttcatct |
5125880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University