View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16051_low_15 (Length: 256)
Name: NF16051_low_15
Description: NF16051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16051_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 23345312 - 23345569
Alignment:
| Q |
1 |
gctgcaaagacacttggtcatgacaaagtttcaatggtatggataccaccatcagctaaatggaggactcttagaaaagcttgtgctacaaaaatattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23345312 |
gctgcaaagacacttggtcatgacaaagtttcaatggtatggataccaccatcagctaaatggaggactcttagaaaagcttgtgctacaaaaatattct |
23345411 |
T |
 |
| Q |
101 |
cacctcaacaacttgacacaacaaagttccatcgcaagagaaaagtgcaagacttgataaactatgt-------------gagaaaggcgaagcatttga |
187 |
Q |
| |
|
|| |||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||| |
|
|
| T |
23345412 |
catctcaacaacttgactcaacaaaattccatcgcaagagaaaagtgcaagacttgataaactatgtgcacaagtgttgcgagaaaggtgaagcctttga |
23345511 |
T |
 |
| Q |
188 |
ttttggagaagttgttcttgcaacagttatgaattcgatatcagaaacgttcatctct |
245 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23345512 |
ttttggagaagtttcttttgcaacagttatgaattcgatatcagaaactttcatctct |
23345569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University