View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16052_high_9 (Length: 310)
Name: NF16052_high_9
Description: NF16052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16052_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 9 - 294
Target Start/End: Complemental strand, 42585335 - 42585050
Alignment:
| Q |
9 |
aggcgtcgacatgttgcgaagggtcgtcaaatttttgcctagaacttgagttatttgcatcattgctattgtctaagaaaccaagtagggtatccatttg |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42585335 |
aggcgttgacatgttgcgaagggtcgtcaaatttttgcctagaacttgagttatttgcatcattgctattgtctaagaaaccaagtagggtatccatttg |
42585236 |
T |
|
| Q |
109 |
ctgacacacaattttctccccaaaaataggggagctttcgaaattattgtaatttccaccatagaattgtccactgtttggttcgactggattgaatcca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42585235 |
ctgacacacaattttctccccaaaaataggggagctttcgaaattattgtaatttccaccatagaattgtccactgttcggttcgactggattgaatcca |
42585136 |
T |
|
| Q |
209 |
tcaggcgattgatataatactgaggcaagagatggaagctcattagtcataatctgatcggtcatggatgggccagaacacaaacc |
294 |
Q |
| |
|
|||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42585135 |
tcaggcaattgatacaatgctgaggcaagagatggaagctcattagtcataatctgatcggtcgtggatgggccagaacacaaacc |
42585050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University