View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16052_low_15 (Length: 285)
Name: NF16052_low_15
Description: NF16052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16052_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 81 - 269
Target Start/End: Original strand, 34020591 - 34020779
Alignment:
| Q |
81 |
tcttgatgattaagatcagcttcatgaagtcacccaaatataatagtgattgacattgctcccaaacaagccaaaaccataaaccctacagctctatttt |
180 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34020591 |
tcttgatgagtaagatcagcttcatgaagtcacccaaatataatagtgattgacattgctcccaaacaagccaaaaccataaaccctacagctctatttt |
34020690 |
T |
 |
| Q |
181 |
gagcagcagagtaataatagtatacatccgtaggctcacccgatacatatatgaacctcggtggaggtggtgttggtggtggtcgtgat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34020691 |
gagcagcagagtaataatagtatacatccgtaggctcacccgacacatatatgaacctcggtggaggtggtgttggtggtggtcgtgat |
34020779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University