View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16052_low_24 (Length: 236)
Name: NF16052_low_24
Description: NF16052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16052_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 49009085 - 49008881
Alignment:
| Q |
15 |
atgaaatcaaggattggtagaagcataatatcctcatcttaacctaagcaatcattaatattcaaggaaacactttaagctctatgggggtgttaattct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49009085 |
atgaaatcaaggattggtagaagcataatatcctcatcttaacctaagcaatcattaatattcaaggaaacactttaagctctatgggggtgttaattct |
49008986 |
T |
 |
| Q |
115 |
gagttgaggctagtcacaacaatgggacttctgacattgtgtttcgagtctgtccaagtgagatacccaaaaactactttattttcctccattttgggac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49008985 |
gagttgaggctagtcacaacaatgggacttctgacattgtgtttcgagtctgtccaagtgagatacccaaaaactactttattttcctccattttgggac |
49008886 |
T |
 |
| Q |
215 |
cttct |
219 |
Q |
| |
|
||||| |
|
|
| T |
49008885 |
cttct |
49008881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University