View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16052_low_25 (Length: 230)
Name: NF16052_low_25
Description: NF16052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16052_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 41 - 100
Target Start/End: Original strand, 22634469 - 22634528
Alignment:
| Q |
41 |
agttgctttttgggtggtgtgtgttttgcttttatcaggaaaaagcaagtgaaatgatac |
100 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22634469 |
agttgcttttttggtggtgagtgttttgcttttatcaggaaaaagcaagtgaaatgatac |
22634528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 217
Target Start/End: Original strand, 22634613 - 22634645
Alignment:
| Q |
185 |
aacaggaaaaagcagagtgctttgcatcttttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22634613 |
aacaggaaaaagcagagtgctttgcatcttttt |
22634645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University